Genetics: Published Articles Ahead of Print, published on November 17, 2008 as 10.1534/genetics.108.095588 Reinventing the Ames Test as a Quantitative Lab that Connects Classical and Molecular Genetics Nathan Goodson-Gregg and Elizabeth A. De Stasio† Biology Department, Lawrence University, Appleton, WI 54911 †To whom correspondence should be addressed: Tel.: 920-832-7682; E-mail:destasie@lawrence.edu Current address: Lawrence University, P.O. Box 599 Appleton, WI 54911-0599 1 Abbreviations used: NaN3, sodium azide; 4NOP, 4-nitro-o-phenylenediamine; VBM, Vogel-Bonner medium E; TBE, 10 mM Tris-HCl pH 8.0 89mM boric acid 1 mM EDTA Keywords: Ames Test, His genes, Reversion Analysis, PCR, DNA Sequence Analysis Running title: Reinventing the Ames Test for Molecular Genetics ABSTRACT While many institutions use a version of the Ames test in the undergraduate genetics laboratory, students typically are not exposed to techniques or procedures beyond qualitative analysis of phenotypic reversion, thereby seriously limiting the scope of learning. We have extended the Ames test to include both quantitative analysis of reversion frequency and molecular analysis of revertant gene sequences. By giving students a role in designing their quantitative methods and analyses, students’ practice and apply quantitative skills. To help students connect classical and molecular genetic concepts and techniques, we report herein procedures for characterizing the molecular lesions that confer a revertant phenotype. We suggest undertaking reversion of both missense and frameshift mutants to allow a more sophisticated molecular genetic analysis. These modifications and additions broaden the educational content of the traditional Ames test teaching laboratory, while simultaneously enhancing students’ skills of experimental design, quantitative analysis, and data interpretation. INTRODUCTION As called for by numerous national groups (e.g. the NRC 2003; Handelsman et al. 2004), biology education has moved in recent years towards the provision of researchrich environments in which undergraduate laboratories are investigative and open-ended and in which quantitative skills are emphasized. While data analysis has long been a staple of student learning, recent research demonstrates that students become most engaged and learn best when they have a hand in the design of experiments as well as the execution and analysis of resulting data (Hake 1998; Merkel 2003; Handelsman et al. 2007). Inquiry-based labs have been shown to improve students’ research skills in biology (Myers & Burgess 2003). Further, as suggested by BIO2010, biology curricula should explicitly build the quantitative skills of budding biologists (NRC, 2003). Hack and Kendall (2005) argue that biology curricula should change because current life science students must learn to use models, to apply appropriate mathematic tools and statistics to solve problems, and to manage and integrate data. That these tools are best taught in the context of biology courses themselves has been demonstrated by Metz (2008), who has shown that undergraduate biology students do not make connections between quantitative concepts taught in mathematics and statistics courses and their application to biological problems. She demonstrates that inclusion of quantitative and statistical analyses in biology laboratory courses led to significant gains in long-term retention of such knowledge, regardless of whether students also had taken courses in statistics. To address the issue of connecting quantitative analysis and biological problem solving, we have extended the open-ended Ames Test for the undergraduate genetics lab to allow students to practice quantitative skills during student-driven experimental design and analysis. Students bring to the lab potential mutagens of their choice and they are charged with both creating methods to determine the number of colony forming units per bacterial culture, and using that figure to determine reversion frequencies. We find that this is a difficult task for students, but having them conclude what sort of serial dilutions are needed, for example, is an important step in gaining a long-term understanding of the quantitative aspects of the lab and other, similar, analyses. This approach requires that instructors and students bring to the lab an attitude of investigation and learning rather than a sense of urgency to ‘do the lab’ and get a particular result. Importantly, this lab also fulfills a second great need within the genetics curriculum, specifically, the ability to directly connect concepts of classical genetics with those of molecular genetics. Investigating both classical and molecular genetics in the time frame of the undergraduate lab requires the use of fast growing organisms with easily selectable phenotypes. Thus, the classic Ames test using Salmonella typhimurium in a reversion screen provided the starting point for the design of this lab. Marshall (2007) has published a yeast-based version of the Ames test that is also investigative in nature. Marshall’s version does not include the level of quantitative analysis described here, nor does she have students perform molecular analysis of revertant genes, though her lab could be extended as we have done with Salmonella. Wessner et al. (2000) has described an initial qualitative spot-overlay experiment followed by a secondary doseresponse experiment as a cost-effective substitute for the traditional Ames test lab. This modification increases the amount of quantitative and qualitative data generated over a period of two to three weeks, but it does not carry the experiment further than classical genetics. The lab described herein has students carry their investigation to the molecular level, including DNA preparation, PCR, and DNA sequencing, thus connecting reversion analysis, an important and rather difficult classical genetic concept, with revertant gene sequences. The lab is cost-effective, and produces substantial classical and molecular genetic data in less than three weeks (two lab session plus sequence analysis). Learning outcomes at the conceptual level of molecular genetics include an enhanced understanding of the fact that multiple DNA sequences can encode a functioning enzyme, and hence can confer the same phenotype, that different mutagens produce different molecular lesions, and that beneficial mutations can be produced spontaneously, as well as classical concepts of mutagenesis and reversion. Students should leave with improved understanding of molecular techniques such as DNA extraction, PCR, DNA sequencing, and sequence comparison. In addition, students’ quantitative skills receive practice in the design of appropriate serial dilutions, computation and understanding of reversion frequency, use of descriptive statistics, and discussions of statistical significance. The original Ames test (Ames 1979) is a reversion screen using Salmonella strains with a His- phenotype due to mutations in HisD or HisG. These Salmonella are plated on histidine-deficient media. Mutagens or other compounds are then added to the plates using one of several application procedures and the number of revertant His+ colonies is enumerated. We report here protocols for adding a quantitative component to this lab in which both spontaneous and mutagen-induced reversion frequencies are experimentally derived. Traditional pedagogical applications of the Ames test end with students simply comparing the numbers of revertant colonies produced by different substances. This process does not allow quantitative comparison between mutagenesis of strains carrying different His- mutations. In addition, when students do a traditional Ames test lab, they do not determine what DNA sequence changes confer revertant phenotypes and thus cannot infer what mutation mechanisms acted on the strains, nor can they fully understand the concept of reversion. Recently, some research laboratories have used DNA sequence analysis in conjunction with the traditional Ames test (Abu-Shakra et al. 2000; Levine et al. 1994) and found strong evidence of substantial sequence variation among revertants of a given strain (Koch et al. 1994). We report here a new protocol that allows students to analyze the molecular lesions that confer the His+ phenotype in revertants of strains carrying either a missense or frameshift His- mutation in HisG or HisD, respectively. The variability in the molecular lesions between these revertants will give students concrete, experimentally-derived examples of the connection between phenotype and genotype by showing students that there are many ways that gene sequences can evolve to confer a specific phenotype. Students will also find that treatment with known mutagens preferentially induces specific types of mutations (e.g. transitions, deletions) that correlate to the mutagenic properties of these substances (Takiya et al. 2003). Data produced in this lab can also provide a starting point for discussions of mutation mechanisms, DNA repair, and molecular evolution. EXPERIMENTAL METHODS & LAB TIMING Strains and media: Salmonella strains TA98, TA100, and TA102 were obtained from BioReliance. Strains TA1535 and TA1538 were obtained from ATCC. Only strains TA1535 and TA1538 are used in the final teaching laboratory, as they are readily available and produce consistent results easily analyzed by undergraduates. Overnight cultures were grown in 10 mL L. medium (1% tryptone, 0.5% yeast extract, 0.5% NaCl, 0.1% glucose) at 37oC. Nutrient-rich plates contained L. medium with 1.5% bacto agar; nutrient-deficient plates contained VBM (0.02% MgSO4*7H2O, 0.2% citric acid, 1.0% K2HPO4, 0.35% NaNH4HPO4, 1.5% bacto agar, 2.0% dextrose). Three mL overlay agar (9.7X10-11% L-histidine, 1.1X10-3% Biotin, 0.55% agar, 0.45% NaCl) was used to plate Salmonella strains. Week 1 – CFU determination and Ames test, One 3-hour lab Determining CFUs in Bacterial Cultures: To allow students to quantify reversion frequencies, students determine the colony-forming unit (CFU) content of their overnight cultures. Students are told to expect 2x108-2x109 CFUs/mL in overnight cultures of Salmonella. Students must determine how to appropriately and accurately dilute their cultures to reach 100 colonies per plate, taking into account the expected bacterial concentration and volume to be plated. They typically plate 100µL of two dilutions, between 1x10-6 and 5x10-7, on nutrient-rich agar. Plates are incubated for 24 hrs at 37oC after which students count individual colonies. Students must then use this information to determine how many His- bacteria were plated in their Ames test. Inducing Mutagenesis via the Ames Test: To produce His+ revertants, 100µL of a TA1535 or TA1538 overnight culture is mixed with 3mL top agar and immediately plated on VBM. After allowing the top agar to harden, 10µL of a potentially mutagenic substance is pipetted onto a sterile 0.65 cm filter paper disc. Pairs of students are encouraged to test the mutagenicity of two substances they bring to lab as well as both control substances; solid substances such as food products are placed in a studentdetermined portion of water and blended. We obtained the best results when no more than a half-volume of water was used to blend solids. The disc is then placed, mutagen side down, on the center of the top agar overlay. Potentially mutagenic test substances that are not water-soluble are plated via direct application to the center of the plate. Positive controls include NaN3 at 0.05 mg/mL for strain TA1535 and 4NOP at 0.5mg/mL for strain TA1538, though both mutagens are tested with each strain. Test substances, such as uncooked foods, that might contain substantial amounts of other microorganisms can be autoclaved or filter sterilized, if sufficiently liquid, before application. Alternately, the potential mutagen can be plated directly without Salmonella on VBM to confirm the absence of these potential contaminants. In our experience, contaminating bacteria are seen at very low frequency and are easily distinguished from the Salmonella colonies. Plates are incubated at 37oC for 48 hours. Revertant colonies are counted in a manner that does not contaminate the plates. Students circle which revertant colony they would like to use for molecular analysis and plates are stored at 4oC. Instructors may wish to provoke a discussion concerning how one would rigorously determine the mutation spectrum of a substance, leading students to realize that spontaneously derived mutants will also be present at lower frequency in any mutation-induced collection of revertants. In a research setting, it might therefore be best to sequence every revertant from a single plate and compare the mutations observed to those seen from spontaneously generated revertant sequences. To give the students more control over the lab experiment, however, one independent revertant colony identified by each student is picked with a sterile inoculating loop and grown overnight in 10mL L. medium prior to the next lab. Week 2 - Characterizing Molecular Lesions Conferring a His+ Phenotype, 2 hours To isolate genomic DNA from liquid cultures of Salmonella: Qiagen DNeasy™ mini-prep spin columns were used as per manufacturer’s instructions. We designed primers to amplify 491 and 487 base pair (bp) fragments that flank His- mutations of hisG46 (in TA1535) and hisD3052 (in TA1538), respectively. Base pair assignments denote position relative to the start codon of respective His coding region (Figure 1): hisG (sense)=5’-CGCTTTACGCATAGCT-3’ (bp 16), hisG (antisense)= 5’AGCTTCAAGCGTCGC-3’ (bp 537), hisD (sense)= 5’-CCGTCTGAAGTACTG-3’ (bp 706), hisD (antisense)= 5’-TCAATGGTTGATGCC-3’ (bp 1223). Each thermocycler reaction contains: 21µL nuclease free water, 1µL each of sense and antisense primers for the appropriate gene (at 12.5 pm/µL), 2µL template DNA, and 25µL of clear Promega Master Mix (3mM MgCl2, 400µM dNTPs, and 50 units/mL Taq polymerase). The optimal annealing temperatures for hisG and hisD primers necessitate separate thermocycling for each set. Thermocycler programming is: 5 min 94oC, 30 cycles of: 2 min 94oC, 30 sec 38oC (hisG primers)/44oC (hisD primers), 2 min 72oC, and a final elongation time of 20 min at 72oC. Following PCR amplification, amplicons are purified using Qiagen QIAquick™ spin columns; gel electrophoresis using 1.5% agarose with TBE can be performed to confirm the presence of desired fragments. Purified amplicons (10-20ng) and 3-5 pmole sense primer were sent to the Yale University DNA facility for sequencing. Sequence data were analyzed using MacVector™ and compared to both the sequences from Salmonella LT2 (wild type), and TA1535/TA1538 (NCBI). For class use, DNA sequences can be compared using NCBI’s BLAST engine: http://blast.ncbi.nlm.nih.gov/Blast.cgi. Full text lab handouts may be obtained from www.lawrence.edu/fast/DESTASIE/protocols.html. RESULTS Bruce Ames & colleagues produced a number of Salmonella strains with mutations in the his operon, two of which we recommend for use in the undergraduate genetics lab. We identified strains with different His- mutations so students could see for themselves how secondary mutations lead to reversion of a missense vs. a frameshift mutation. After experimenting with five Salmonella strains: TA98, TA100, TA102, TA1535, and TA1538; we identified two strains for which assays provided reproducible, countable numbers of spontaneous revertant colonies from easily measured quantities of overnight cultures. In three replicate experiments, both TA100 and TA102 produced over 100 very large spontaneous revertants per plate; the excessive number and size of colonies produced made accurate counting difficult as colonies often merged. Strains TA98, TA1535, and TA1538 each produced between 10-50 spontaneous revertants per plate. TA1535, containing a missense T->C allele of hisG (hisG46) and TA1538, containing a -1 frameshift mutation in hisD (hisD3052) were selected for use, and all data that follow are derived from experiments with these two strains. To accurately calculate reversion frequencies, experiments were conducted to determine the average CFU content of overnight cultures. Overnight cultures of TA1535 consistently grew to a slightly higher density than did TA1538, with an average of 4.5x108 compared to 3.9x108 CFUs/mL, respectively (n= 36). TA1535 and TA1538 colonies looked similar after approximately 24 of incubation. Excessive incubation periods (>24 hours) produced large colonies in both strains which merged and made colony counting difficult. It is desirable to have students use known mutagens as positive controls that have the lowest possible toxicity to humans and have different mutation spectra. NaN3 and 4NOP were identified for this purpose. NaN3 is known to induce missense mutations (Olsen et al. 1993) while 4NOP primarily induces deletions and insertions (Ames et al. 1975). Because TA1535 contains a missense allele (of HisG) and TA1538 contains a frameshift allele (of HisD), each mutagen should produce a different reversion frequency with the two Salmonella strains. As expected, NaN3 and 4NOP did produce revertants at very different frequencies in the two Salmonella strains used; each treatment only exceeded the spontaneous reversion rate in the expected strain. The spontaneous reversion rate of TA1535 was 2.3x10-7 per CFU while TA1538 spontaneously reverted at a rate of 1.4x10-7 per CFU (Figure 2). After testing mutagen concentrations ranging from 1.0 mg/mL to 0.0001 mg/mL, we used concentrations that yielded reversion rates significantly higher than the spontaneous rate, but for which the number of revertant colonies per plate could be enumerated by hand. Significant increases in the reversion rate to 8.9x10-7 and 2.1x10-6 revertants per CFU were observed in TA1535 after treatment with 0.025 mg and 0.05 mg NaN3/mL, respectively. Similarly, treatment of TA1538 with 0.25 and 0.5 mg 4NOP/mL produced significant increases in the reversion rate to 1.6x10-6 and 2.7x10-7 revertants/CFU, respectively. Treatment of TA1535 with 4NOP and of TA1538 with NaN3 produced reversion rates that were virtually identical to the spontaneous reversion rate for each strain. Students will note that colonies of strain TA1535 are larger than those of TA1538. Students should also note that, after treatment with 4NOP, strain TA1538 produces large numbers of small colonies that aggregate around the center of the plate, indicating the lower diffusion rate of 4NOP. At the recommended concentrations, kill zones surrounding the filter paper disc will not be observed with either strain. It should be noted that the calculated reversion frequencies will be more rigorously quantitative for the spontaneous reversion frequency, and that comparisons between mutagens are more difficult. Mutagen-induced frequencies should be considered conservative estimates due to possible differences in mutagen diffusion rates through the top agar. In our hands, water-soluble substances appear to diffuse uniformly from the centrally placed discs, as indicated by uniform distributions of revertants across the plate. Students will, however, notice that 4NOP does not fully diffuse across the plate (it is minimally water soluble) and revertants will be clustered within an approximately three cm radius of the disc. This fact does not diminish the importance of the quantitative data analysis as one can still rigorously compare the response of the two different Salmonella strains to 4NOP and see that reversion frequencies differ substantially. Students should be led to understand that reversion frequencies of 4NOP and any other less soluble substances should be reported as minimal reversion frequencies as CFUS plated outside the diffusion zone will not have been exposed to mutagen while bacteria within the diffusion zone may be exposed to a gradient of mutagen. It is a good lesson for students to realize that even quantitative results are subject to bias of various sorts and must be based on experiments where as many variables are controlled as possible. Students should be encouraged to brainstorm other methodologies that would ensure uniform distribution of mutagens, such as inclusion in the top agar before plating (though the increased temperature here might be problematic). We note that we don’t use other methodologies in the teaching lab because we prefer to minimize the spread of toxic mutagens to glassware that is handled by undergraduates. The disc method keeps the mutagen application in a defined space with minimal ‘spread’ around the lab. To determine whether students will see significant mutagenesis after treatment with substances of their choice, we subjected twenty-four substances to a qualitative assay (Table 1) using our updated protocol. Perishable food products were plated on VBM without Salmonella strains to confirm that they did not contain other microorganisms; only bread and chewing tobacco produced bacterial colonies. Two application procedures were used for each substance, and treatments that produced at least a 50% increase in the reversion frequency were quantitatively tested for potential mutagenicity (Figure 3). Five substances were found to be potentially mutagenic in at least one strain (Figure 3). Each treatment produced significant mutagenesis in TA1538, but only direct application of melted Carmex lip balm induced mutagenesis in both strains. Carmex treatment increased the reversion frequency to 5.3x10-7 revertants per CFU in TA1535 and 6.4x10-7 revertants per CFU in TA1538. We started a database of various mutations that confer the His+ phenotype, to which students will add. Genomic DNA was prepared from TA1535 and TA1538 as described and sequenced to confirm the integrity of our initial strains. The resulting sequences were exactly as described (NCBI accession J01804). Five spontaneous revertants and at least five mutagen-induced revertants from each strain were prepared from two separate experiments and were sequenced to determine typical mutation tendencies. Variation in the kinds of mutations conferring the His+ phenotype was observed (Table 2 and 3). Two different reversion mutations were found in a two base region of hisG in strain TA1535 (Table 2), directly reverting the original His- mutation (site 2) or changing the C one base upstream (site 1). Reversion to the LT2 (wild-type) sequence of hisG, a C T transition at site 2, was the most common mutation (40% of sequenced hisD alleles), replacing the mutant proline with wild-type leucine. Three isolates of a C A transversion were also observed in TA1535 at site 2, encoding a histidine at the same site of the enzyme. A revertant found after treatment of TA1535 with hand sanitizer included a C T transition at site 1 in two revertant colonies, and an identical mutation was observed in one spontaneous revertant colony. These alleles substitute a serine for the mutant proline. A great deal of variation was observed in hisD base sequence of TA1538 revertant alleles. The site of indel mutations (insertions and deletions) spanned a 30 base region encompassing the original mutation site. A sampling of these mutations is presented (Table 3), 4NOP was the only treatment that produced the same mutation twice. The mutations conferring the His+ phenotype in TA1538 are best characterized by the net effect of the insertions and deletions found in each allele, relative to the wildtype (LT2) hisD sequence (Table 4). All revertant alleles did restore reading frame, but some added new amino acids as well. The most common mutation was a net deletion of three bases, which restored the correct reading frame (50% of alleles). Students will find it interesting that none of the revertant colonies of TA1538 contained a wild-type sequence for the hisD gene. A sequence database, including sequence of wild-type alleles is available at: www.lawrence.edu/fast/DESTASIE/protocols.html. We optimized the protocols for characterizing molecular lesions to maximize the success rate. We define final success as the generation of a positive sequencing result (base sequence) that could yield a His+ phenotype. Agarose gel electrophoresis was performed after each intermediate step leading to base sequence analysis (genomic DNA preparation, PCR amplification, and PCR product purification) to ensure the presence of desired products. After all of these treatments, DNA fragments of the appropriate size (Figure 4) were observed from DNA preparations from revertant strains that were prepared with our optimized protocol and the appropriate primer set 100% of the time. DNA concentrations of the final purified PCR products were calculated by both gel electrophoresis and spectrophotometric analysis at 260 nm. Typical DNA concentrations were found to be between 5 and 20 ng/µl. To prevent lab congestion, save time, and reduce material expenses, students do not need to determine the DNA concentration of their final product. Instead, all DNA concentrations are assumed to be 10 ng/µl after PCR amplicon purification and samples were prepared as per the off-site sequencing facility’s recommendation. Out of 38 samples prepared in this manner and sequenced, only one did not produce a positive result, and a positive result was obtained after this sample was sequenced again. → → → DISCUSSION We designed and field-tested a two-week, investigative lab for an intermediate level undergraduate course in genetics using the classical Ames test as a starting point. The lab allows students to play a role in experimental design and it is open-ended and discovery-based. Students produce both quantitative data that can be statistically compared and qualitative sequence data that can be analyzed for effect on amino acid code and reading frame. The main advantages to the enhanced lab are its emphasis on quantitative analysis and the explicit connection made between reversion phenotype and gene sequences. We have increased the efficacy, rigor, and quantitative aspects of the lab compared to the usual implementation of the classic Ames test. Students directly measure, based on serial dilutions of their own design, the CFUs in overnight cultures to calculate reversion frequencies rather than simply count revertant colonies. This is a classical genetic measurement and one that undergraduates often have difficulty grasping. The technique of serial dilution is often equally mysterious to students. Measuring and calculating both dilutions and using them to calculate frequencies aids student understanding of these quantitative techniques (see assessment, below). The classic Ames test was further extended to include a molecular genetic investigation, allowing students to see first-hand the direct connection between a phenotype (His- and His+) and DNA sequences. Students choose a revertant colony for study, extract genomic DNA, use PCR to amplify large regions of the affected genes, use a core facility to produce DNA sequence, align and analyze the resulting sequences, and correlate to phenotype. The procedures we designed have been 97% effective in producing useable molecular data (base sequences). DNA preps using Qiagen’s DNAeasy™ kit, PCR done with Promega’s clear Master Mix, and the indicated thermocycling have never failed with our protocols, obviating the need for an intermediate step of gel electrophoresis. DNA sequences and chromatograms arrive from core facilities as electronic files, and freely available software is used to align and compare sequences. Students will still need to use their own common sense however when comparing frameshift alleles, as the simple alignment tool does not always ‘see’ insertions or deletions as well as the human eye. We suggest the use of Salmonella strains with different His- mutations so students can observe for themselves the connection between DNA sequence and phenotype, the types of lesions induced by different mutagens, and how the secondary mutations lead to reversion of a missense vs. a frameshift mutation. Use of both NaN3 and 4NOP as positive controls allows students to discover that mutagens can have different mutation spectra. TA1535 is not significantly reverted by 4NOP. NaN3 does not produce significant revertants of TA1538, demonstrating that different types of mutations are needed for reversion in these two strains. When students receive and analyze their revertant sequences, they will note that 4NOP does indeed produce specific frameshift mutations and NaN3 exposure is correlated with missense mutations. This lab lends itself very well to written analysis of the data in manuscript form. To maximize student learning, class data should be pooled to some degree so that variability in overnight culture concentration is obvious and the need to account for it by calculating reversion frequency, rather than simply comparing numbers of revertant colonies directly is clear. In addition, a larger data set will allow students to see first hand that 1. Reversion in each strain requires a different type of revertant mutation, 2. Different mutagens and the spontaneous mechanisms have particular mutation spectra and 3. Multiple DNA sequences can encode a functional enzyme. We suggest instructors begin a database of revertant sequences generated by their classes to which each year’s class will add data. Instructors could manipulate data release to have students compare data sets of different sizes such that students can see how collecting larger data sets allows scientists to see trends more clearly. The learning outcomes from this lab are numerous and instructors can use data generated in this lab during many different points in a typical genetics course. The use of model organisms as test subjects due to the universality of DNA structure and function should be made explicit at the outset of the lab. The concept of reversion is often difficult for students to grasp, but adding the molecular analysis to this lab makes it clear that multiple types of mutations can create a functional gene product from the original His- genotype. Instructors can then build on student knowledge from this lab when introducing the concept of suppressor screens. The connection between phenotype, genotype, and alleles will be explicit and tangible since students will have produced data at all three levels themselves. Instructors may then make connections between the gene sequences and protein structure, molecular evolution, and mechanisms of mutation as they desire. They can refer to this lab when discussing the importance of DNA repair (these strains have a uvrB mutation which eliminates the excision repair mechanism) and the error-prone nature of DNA replication and repair. Further extension of this lab is possible. S9 rat liver extract can be incorporated into the histidine-deficient media to mimic the metabolic action of the mammalian liver with additional expense. Students could design the PCR primers and optimize PCR or they could see their PCR amplicon in an agarose gel prior to or after amplicon purification. Assessment To test the efficacy of this lab, ten summer research students were recruited to field-test the lab; six of these students had taken genetics the previous year (and done a traditional, qualitative Ames test) and the rest had not. Students were given two pre-tests, a self-assessment of knowledge and a problem-based objective test in which half of the questions tested quantitative skills (e.g. dilutions, frequency calculations) and the rest covered concepts that connect classical and molecular genetics (e.g. what is a reading frame?). A short pre-lab lecture on the development and utility of the Ames test and the concept of reversion analysis preceded implementation of the lab. Students had no difficulty following the procedures, though many needed help determining how to prepare and use serial dilutions, in spite of doing lab-based research full-time for the previous 10 weeks. Three days later, students collected data and determined reversion frequencies. To shorten the volunteer time needed, students were provided with sequence data for four mutant alleles and asked to compare them to wild-type sequence and determine the molecular basis of the revertant phenotype. Each pair of students was asked to summarize their findings orally. Students were especially interested in the fact that a simple base substitution mutation produced a His+ reversion in TA1535, but complex indels were required to restore the reading frame and confer the His+ phenotype in TA1538. Following the summaries, the students completed the post-tests and a series of questions evaluating the lab directly. Pre- and post-test scores demonstrated students’ marked improvement in understanding both the quantitative and molecular aspects of the lab (Figure 5). Pre- and post-tests were coded and mixed by a third party prior to scoring. Pre-test scores indicated that even students who had taken Genetics the previous year had difficulty with the quantitative analysis and serial dilutions associated with this lab, skills not used in the traditional Ames test they had done the previous year. In spite of the fact that one of our introductory biology labs has students undertaking serial dilutions (with explicit directions, not designed by the students), no student scored perfectly on this question on the pre-test, underscoring the need to have students practice this skill repeatedly and designing the dilutions themselves with a particular goal in mind. Paired scores were raised by an average of six points out of 19 total (Figure 5). Average pre- and post-test scores were significantly different (p<0.001, paired 2 sample T test). Self-assessment of student knowledge and skills also increased from pre- to postlab. Students anonymously rated their understanding of 12 concepts or skills on a 5-point scale (1=very poor understanding, 2=poor understanding, 3=neutral understanding, 4=good understanding, 5=excellent understanding), including such questions as “I feel comfortable calculating mutation frequencies” and “I understand how to use and analyze a DNA sequence.” Students’ confidence increased after completion of the lab and its analysis; ratings increased by an average of 1.6 points on the 5-point scale. The differences between average pre- and post-lab responses for each question were all significantly different (p< 0.05, paired 2 sample T test), with the exception of the question “I understand how to use and analyze DNA sequence” (p<0.07). Student responses were abnormally high to this question in the pre-lab self-assessment (3.8), but nonetheless, an increase (to 4.8) was observed after the lab and analysis. Anonymous student assessment of the lab itself was very positive. Average responses to questions such as “this lab should be part of the Genetics curriculum,” and “Other students would benefit from the skills learned in this lab” were rated, on average, 4.4 and 4.5 on a 5-point scale (1=strongly disagree, 2=somewhat disagree, 3=neutral, 4=somewhat agree, 5=strongly agree). In space reserved for written comments about the lab, students wrote “Having my own input, ‘my mutagen,’ I was more excited to learn the results and why they occurred,” and “I like the addition of sequencing, using my own potential mutagen.” Students also commented on the skill-building aspects of the lab: “The addition of the quantitative component enhanced [my] understanding of the concept of reversion frequency,” and “[There were] a variety of techniques from microbiology, molecular biology, and genetics. This lab really brings it all together.” In conclusion, we developed a new multi-week investigative lab that addresses two very important issues in a genetics curriculum. The lab adds rigorous quantitative analysis as well as molecular genetics to the classic Ames test. The lab has been well received by students and has been shown in a pilot study to improve student skills and knowledge on an objective test as well as their confidence, based on self-assessments. ACKNOWLEDGEMENTS The authors wish to thank JoAnn Stamm and Wayne Krueger for technical assistance, the 2008 summer research students for field-testing the lab, and a curricular development grant from the Provost’s office at Lawrence University. This manuscript benefited from the comments of two anonymous reviewers. Literature Cited Abu-Shakra, A., E. T. McQueen, and M. L. Cunningham, 2000 Rapid analysis of base-pair substitutions induced by mutagenic drugs through their oxygen radical or epoxide derivatives. Mutat. Res. 470: 11-18 Ames, B. N., 1979 Identifying environmental chemicals causing mutations and cancer. Science. 204: 587-593 Ames, B. N., H. O. Kammen, and E. Yamasaki, 1975 Hair dyes are mutagenic: identification of a variety of mutagenic ingredients. 72: 2423-2427 Hake, R. R., 1998 Interactive-engagement versus traditional methods: A six-thousandstudent survey of mechanics test data for introductory physics courses. Am. J. Phys., 66: 64-74. Hack, C., and G. Kendall, 2005 Bioinformatics: Current practice and future challenges of life science education. Biochem. Mol. Biol. Educ. 33:82-85. Handelsman, J., D. Ebert-May, R. Beichner, P. Bruns, A. Chang, R. DeHaan, J. Gentile, S. Lauffer, J. Stewart, S. M. Tilghman, W.B. Wood 2004 Education: Scientific teaching. Science 304(5670): 521-522. Handelsman, J., S. Miller, C. Pfund, 2007 Scientific Teaching The Wisconsin Program for Scientific Teaching, Roberts & Co and W.H. Freeman New York, NY. Koch, W. H., E. N. Henrikson, E. Kupchella, and T. A. Cebula, 1994 Salmonella typhimurium strain TA100 differentiates several classes of carcinogens and mutagens by base substitution specificity. Carcinogenesis. 15: 79-88 Levine, J. G., R. M. Schaaper, and D. M. DeMarini, 1994 Complex frameshift mutations mediated by plasmid pKM101: mutation mechanisms deduced from 4aminobiphenyl-induced mutation spectra in Salmonella. Genetics. 136: 731-746 Marshall, P.A., 2007 Using Saccharomyces cerevisiae to test the mutagenicity of household compounds: An open ended hypothesis-driven teaching lab. CBE-Life Sciences Education. 6: 307-315. Merkel, C., 2003 Undergraduate research at the research universities. New Directions of Teaching and Learning. 93: 39-53. Metz, A., 2008 Teaching statistics in biology: Using inquiry-based learning to strengthen understanding of statistical analysis in biology laboratory courses. 7: 317-326. Myers, M.J., and A.B. Burgess, 2003 Inquiry-based laboratory course improves students’ ability to design experiments and interpret data. Advan. Physio. Educ. 27: 26-33. National Center for Biotechnology Information, 2008 S. typhimurium his operon encoding ATP phosphoribosyl transferase (hisG), histidinol dehydrogenase (hisD), histidinol phosphate aminotransferase (hisC) complete cds, and imidazoleglycerol phosphate dehydratase (hisB), 5’ end. http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=154116 (accessed 27 June 2008). NRC, 2003 BIO2010: Transforming Undergraduate Education for Future Research Biologists. L. Stryer, Ed. National Academy Press, Washington, DC. → Olsen, O., W. Xingzhi, D. V. Wettstein, 1993 Sodium azide mutagenesis: preferential generation of A.T G.C transitions in the berley Ant18 gene. Proc. of Nat. Acad. of Sci. of the USA. 90: 8043-8047 Takiya, T., Y. Horie, S. Futo, Y. Matsumoto, K. Kawai, and T. Suzuki, 2003 Rapid selection of non-hotspot mutants among hisD+ Revertants of Salmonella typhimurium TA98 in Ames test by peptide nucleic acid (PNA)-mediated PCR clamping. J. of Biosci. and Bioeng. 96: 588-590 Wessner, D. R., P. C. Maiorano, J. Kenyon, R. Pillsbury, and A. M. Campbell, 2000 Spot-overlay Ames test of potential mutagens. Assoc. Biol. Lab Educ. 22: 1-18 FIGURE 1. The hisG and hisD genes of S. typhimurium and the location and sequence of the mutation sites found in TA1535 and TA1538, respectively. Amino acid (AA) sequences are shown under the base sequences. Mutations conferring His phenotype are shown in bold and are surrounded by bases and AAs to indicate the effect of the mutation on the protein sequence. PS and PA denote binding sites for sense and antisense primers used in PCR. Base locations are relative to the first base of the respective coding regions. FIGURE 2. Reversion frequency, measured in revertants/CFU, of TA1535 and TA1538 after exposure to H20 (negative control), and indicated concentrations of NaN3 and 4NOP. n=15; error bars = 1SE. FIGURE 3. Reversion frequency, measured in revertants/CFU, of TA1535 and TA1538 after exposure to H20 (negative control), and various suspected environmental mutagens. Application procedure was 10 µL on filter paper or direct application (DA). n=15 for H20 treatments and n=3 for all other treatments. Error bars = 1 SE. FIGURE 4. 1.5% agarose gel of purified PCR products. 1-3 were amplified with hisG primer set, and 4-6 were amplified with hisD primer set. M= Hi-Lo DNA marker; 1-3= TA1535 overnight culture, spontaneous revertant, and 0.05 mg/mL NaN3 induced revertant respectively; 4-6= TA1538 overnight culture, spontaneous revertant, and 0.5 mg/mL 4NOP induced revertant respectively. Figure 5. Average student scores on an objective assessment of concepts and quantitative skills before and after completing the laboratory exercise. Sample questions include “Describe how to use serial dilution to produce 100 bacterial colonies on a plate when the starting bacterial 6 overnight culture is expected to contain 10 bacteria per ml. Assume you place 100 ul of your final dilution on the agar plate” and “What is meant by ‘reading frame?’” Scores are out of 19 possible points. n=10. Error bars = 1 SD. Figure 6. Average scores of 12 subjective self-assessment questions before (pre-lab) and after (post-lab) completing the described laboratory exercise. Students ranked their response to questions such as “I understand the concept of reversion frequency” and “I understand how to measure the concentration of a bacterial culture” on a 1-5 scale (1=very poor understanding, 5=excellent understanding). n=10 students Error bars= 1 SD Substances Tested A-C Substances Tested D-Z Artificial vanilla flavoring Deoderant Artificial sweetner Diet cola Bread crust Ethidium bromide Burnt bread crust Hair Dye Burnt hamburger Hand sanitizer Carmex Organic coffee (caffinated) Celery Peanut butter Cigar tobacco Rat poison Cigar ashes Stone-ground mustard Chewing tobacco Super glue Coffee (caffinated) Tea (caffinated) Cooked hamburger Tea leaves (caffinated) TABLE 1. Different environmental substances qualitatively tested for potential mutagenicity. → → Treatment H20 C T 3 C A 2 NaN3 Organic Coffee Hand Sanitizer 2 0 2 0 1 0 TABLE 2. Different molecular lesions conferring the His+ phenotype in strain TA1535 after treatment with various substances. Treatment DNA Sequence (base 880-910) LT2 (wild-type; none) cgcgcggacaccgcccggcaggccctgagc TA1538 (His mutant; none) cgcgcggacaccgcc ggcaggccctgagcg H20 (spontaneous revertant) cgcgcggacaccgcc ggccaggccctgagc ggacaccgccgcggcaggccctgagcgcc 4NOP c Organic Coffee (DA) cgcgcggacaccgcc ggcagtagaacgtca Insertions Deletions Net ∆ 0 0 0 0 1 -1 1 1 0 2 10 5 1 -3 9 TABLE 3. Samples of insertion and deletion reversion mutations of TA1538 and the net effect of these molecular lesions. 30 base sequence shown from base 880, relative to the start codon of hisD. All bases are contiguous; gaps indicate deletions of bases relative to LT2 sequence. Bold letters indicate insertion. Net ∆= net effect of insertions and deletions in # of bases relative to LT2. Treatment Deletion of 3 Deletion of >10 H20 2 1 4NOP 2 0 Organic Coffee 0 0 Artificial Vanilla 1 1 Hand Sanitizer 1 1 Insertion 2 0 1 0 0 + TABLE 4. The net effect of different molecular lesions conferring the His phenotype in strain TA1538 after treatment with various substances relative to wild type LT2 sequence.